mir sensor assay (Addgene inc)
Structured Review
Mir Sensor Assay, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bmpr2/pmirGLO-Bmpr2-1719+(Plasmid+%2349379)/bio_rxiv__2025__11__21__689335-78-11-18
Average 93 stars, based on 1 article reviews
Images
Related Articles
Sequencing:Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis. Article Snippet: .. The identified BMPR2 variants were introduced into the Polymerase Chain Reaction:Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis. Article Snippet: .. The identified BMPR2 variants were introduced into the Amplification:Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis. Article Snippet: .. The identified BMPR2 variants were introduced into the Mutagenesis:Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis. Article Snippet: .. The identified BMPR2 variants were introduced into the Plasmid Preparation:Article Title: MIR17HG Expression Is Transcriptionally Regulated by PAX3::FOXO1 and MYCN and is Necessary for Oncogenic Activity in Fusion-Positive Rhabdomyosarcoma Article Snippet: .. To evaluate the efficacy of the miRNA-sponges , we used the Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Microarray:Article Title: BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Normal donkey serum Sigma Cat#D9663 Rat anti-ER-TR7 Abcam Cat#ab51824, RRID:AB_881651 Rabbit Anti-GFP Invitrogen Cat#A11122, RRID:AB_221569 Rabbit Anti-Eomes/Tbr2 Abcam Cat#ab23345, RRID:AB_778267 Mouse Anti-Tbx21 Abcam Cat#ab91109, RRID:AB_2050371 Alexa 488-conjugated donkey anti-rat IgG Thermo Fisher Scientific Cat# A-21208; RRID:AB_2536180 Alexa 488-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-21206; RRID:AB_2536180 Alexa 555-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-31572; RRID:AB_2536180 Alexa 555-conjugated donkey anti-mouse IgG Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 Chemicals, peptides, and recombinant proteins Paraformaldehyde Nacalai Tesque Cat# 26126-25 Low-melting point agarose Thermo Fisher Scientific Cat# 16520-100 OCT compound Sakura Ca# 4583 Saponin Nacalai Tesque Cat# 30502-42 Omnipaque 350 Daiichi-Sankyo N/A DAPI solution DOJINDO Cat# D523 Nembutal Dainippon Sumitomo Pharma N/A Somnopentyl Kyoritsu Seiyaku N/A Ketamine Daiichi-Sankyo N/A Xylazine Bayer N/A RNeasy Plus Mini Kit Quiagen Cat# 74134 SuperScript IV Thermo Fisher Scientific Cat#18090010 Oligo(dT)20 primer Invitrogen Cat#18418020 Low Input Quick Amp Gene Expression Labeling Kits Agilent Cat#5190-2331 SuperPrint G3 Mouse GE 8x60K Microarray Kit Ver 2.0 Agilent Cat# G4852 PowerUP SYBR Green Master Mix Thermo Fisher Scientific Cat# A25742 NMDA Nacalai Cat#22034-1 Glycine Sigma Cat#G7126-100G AP5 Sigma Cat# A5282 AMPA TOCRIS Cat#0169 TTX Abcam Cat# ab120055 Alexa Fluor 555 Tyramide Reagent Thermo Fisher Scientific Cat#B40955 Critical commercial assays RNA scope probe Bmp2 Advanced Cell Diagnostics Cat#406661 RNA scope probe Bmp4 Advanced Cell Diagnostics Cat#401301 RNA scope 2.5HD Reagent kit Brown Advanced Cell Diagnostics Cat#322300 Deposited data Raw image data This paper https://doi.org/10.24631/ssbd. repos.2021.04.001 Neurolucida tracing data This paper http://neuromorpho.org/ (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Microarray data This paper https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE171875 Experimental models: organisms/strains ICR mice Japan SLC RRID:MGI:5462094 C57BL/6N mice Japan SLC RRID:MGI:5295404 Thy1-GCaMP6f (C57BL/6J-Tg(Thy1GCaMP6f)GP5.11Dkim/J) The Jackson Laboratory Cat# JAX:024339; RRID:IMSR_JAX:024339 Oligonucleotides Thy1-GCaMP6f genotyping primer, forward: CTGACTGAAGAGCAGATCGCAGAAT Dana et al., 2014 N/A Thy1-GCaMP6f genotyping primer, reverse: GCAGCGTATCCACATAGCGTAAAAG Dana et al., 2014 N/A qPCR primers This paper, See Table S5 N/A Recombinant DNA pCAG-FLPo Fujimoto et al., 2019 Addgene # 125576 pCAFNF-tdTomato Fujimoto et al., 2019 Addgene # 125575 pCAX-Cas9 Tsunekawa et al., 2016 Gift from Dr. Matsuzaki Bmpr2 gRNA#1 This paper Addgene # 163388 Bmpr2 gRNA#2 This paper Addgene # 163389 Bmpr2 gRNA#3 This paper Addgene # 163390 Real-time Polymerase Chain Reaction:Article Title: BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Normal donkey serum Sigma Cat#D9663 Rat anti-ER-TR7 Abcam Cat#ab51824, RRID:AB_881651 Rabbit Anti-GFP Invitrogen Cat#A11122, RRID:AB_221569 Rabbit Anti-Eomes/Tbr2 Abcam Cat#ab23345, RRID:AB_778267 Mouse Anti-Tbx21 Abcam Cat#ab91109, RRID:AB_2050371 Alexa 488-conjugated donkey anti-rat IgG Thermo Fisher Scientific Cat# A-21208; RRID:AB_2536180 Alexa 488-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-21206; RRID:AB_2536180 Alexa 555-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-31572; RRID:AB_2536180 Alexa 555-conjugated donkey anti-mouse IgG Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 Chemicals, peptides, and recombinant proteins Paraformaldehyde Nacalai Tesque Cat# 26126-25 Low-melting point agarose Thermo Fisher Scientific Cat# 16520-100 OCT compound Sakura Ca# 4583 Saponin Nacalai Tesque Cat# 30502-42 Omnipaque 350 Daiichi-Sankyo N/A DAPI solution DOJINDO Cat# D523 Nembutal Dainippon Sumitomo Pharma N/A Somnopentyl Kyoritsu Seiyaku N/A Ketamine Daiichi-Sankyo N/A Xylazine Bayer N/A RNeasy Plus Mini Kit Quiagen Cat# 74134 SuperScript IV Thermo Fisher Scientific Cat#18090010 Oligo(dT)20 primer Invitrogen Cat#18418020 Low Input Quick Amp Gene Expression Labeling Kits Agilent Cat#5190-2331 SuperPrint G3 Mouse GE 8x60K Microarray Kit Ver 2.0 Agilent Cat# G4852 PowerUP SYBR Green Master Mix Thermo Fisher Scientific Cat# A25742 NMDA Nacalai Cat#22034-1 Glycine Sigma Cat#G7126-100G AP5 Sigma Cat# A5282 AMPA TOCRIS Cat#0169 TTX Abcam Cat# ab120055 Alexa Fluor 555 Tyramide Reagent Thermo Fisher Scientific Cat#B40955 Critical commercial assays RNA scope probe Bmp2 Advanced Cell Diagnostics Cat#406661 RNA scope probe Bmp4 Advanced Cell Diagnostics Cat#401301 RNA scope 2.5HD Reagent kit Brown Advanced Cell Diagnostics Cat#322300 Deposited data Raw image data This paper https://doi.org/10.24631/ssbd. repos.2021.04.001 Neurolucida tracing data This paper http://neuromorpho.org/ (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Microarray data This paper https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE171875 Experimental models: organisms/strains ICR mice Japan SLC RRID:MGI:5462094 C57BL/6N mice Japan SLC RRID:MGI:5295404 Thy1-GCaMP6f (C57BL/6J-Tg(Thy1GCaMP6f)GP5.11Dkim/J) The Jackson Laboratory Cat# JAX:024339; RRID:IMSR_JAX:024339 Oligonucleotides Thy1-GCaMP6f genotyping primer, forward: CTGACTGAAGAGCAGATCGCAGAAT Dana et al., 2014 N/A Thy1-GCaMP6f genotyping primer, reverse: GCAGCGTATCCACATAGCGTAAAAG Dana et al., 2014 N/A qPCR primers This paper, See Table S5 N/A Recombinant DNA pCAG-FLPo Fujimoto et al., 2019 Addgene # 125576 pCAFNF-tdTomato Fujimoto et al., 2019 Addgene # 125575 pCAX-Cas9 Tsunekawa et al., 2016 Gift from Dr. Matsuzaki Bmpr2 gRNA#1 This paper Addgene # 163388 Bmpr2 gRNA#2 This paper Addgene # 163389 Bmpr2 gRNA#3 This paper Addgene # 163390 Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Recombinant:Article Title: BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Normal donkey serum Sigma Cat#D9663 Rat anti-ER-TR7 Abcam Cat#ab51824, RRID:AB_881651 Rabbit Anti-GFP Invitrogen Cat#A11122, RRID:AB_221569 Rabbit Anti-Eomes/Tbr2 Abcam Cat#ab23345, RRID:AB_778267 Mouse Anti-Tbx21 Abcam Cat#ab91109, RRID:AB_2050371 Alexa 488-conjugated donkey anti-rat IgG Thermo Fisher Scientific Cat# A-21208; RRID:AB_2536180 Alexa 488-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-21206; RRID:AB_2536180 Alexa 555-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-31572; RRID:AB_2536180 Alexa 555-conjugated donkey anti-mouse IgG Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 Chemicals, peptides, and recombinant proteins Paraformaldehyde Nacalai Tesque Cat# 26126-25 Low-melting point agarose Thermo Fisher Scientific Cat# 16520-100 OCT compound Sakura Ca# 4583 Saponin Nacalai Tesque Cat# 30502-42 Omnipaque 350 Daiichi-Sankyo N/A DAPI solution DOJINDO Cat# D523 Nembutal Dainippon Sumitomo Pharma N/A Somnopentyl Kyoritsu Seiyaku N/A Ketamine Daiichi-Sankyo N/A Xylazine Bayer N/A RNeasy Plus Mini Kit Quiagen Cat# 74134 SuperScript IV Thermo Fisher Scientific Cat#18090010 Oligo(dT)20 primer Invitrogen Cat#18418020 Low Input Quick Amp Gene Expression Labeling Kits Agilent Cat#5190-2331 SuperPrint G3 Mouse GE 8x60K Microarray Kit Ver 2.0 Agilent Cat# G4852 PowerUP SYBR Green Master Mix Thermo Fisher Scientific Cat# A25742 NMDA Nacalai Cat#22034-1 Glycine Sigma Cat#G7126-100G AP5 Sigma Cat# A5282 AMPA TOCRIS Cat#0169 TTX Abcam Cat# ab120055 Alexa Fluor 555 Tyramide Reagent Thermo Fisher Scientific Cat#B40955 Critical commercial assays RNA scope probe Bmp2 Advanced Cell Diagnostics Cat#406661 RNA scope probe Bmp4 Advanced Cell Diagnostics Cat#401301 RNA scope 2.5HD Reagent kit Brown Advanced Cell Diagnostics Cat#322300 Deposited data Raw image data This paper https://doi.org/10.24631/ssbd. repos.2021.04.001 Neurolucida tracing data This paper http://neuromorpho.org/ (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Microarray data This paper https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE171875 Experimental models: organisms/strains ICR mice Japan SLC RRID:MGI:5462094 C57BL/6N mice Japan SLC RRID:MGI:5295404 Thy1-GCaMP6f (C57BL/6J-Tg(Thy1GCaMP6f)GP5.11Dkim/J) The Jackson Laboratory Cat# JAX:024339; RRID:IMSR_JAX:024339 Oligonucleotides Thy1-GCaMP6f genotyping primer, forward: CTGACTGAAGAGCAGATCGCAGAAT Dana et al., 2014 N/A Thy1-GCaMP6f genotyping primer, reverse: GCAGCGTATCCACATAGCGTAAAAG Dana et al., 2014 N/A qPCR primers This paper, See Table S5 N/A Recombinant DNA pCAG-FLPo Fujimoto et al., 2019 Addgene # 125576 pCAFNF-tdTomato Fujimoto et al., 2019 Addgene # 125575 pCAX-Cas9 Tsunekawa et al., 2016 Gift from Dr. Matsuzaki Bmpr2 gRNA#1 This paper Addgene # 163388 Bmpr2 gRNA#2 This paper Addgene # 163389 Bmpr2 gRNA#3 This paper Addgene # 163390 Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Luciferase:Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Expressing:Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] |

