Review



mir sensor assay  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc mir sensor assay
    Mir Sensor Assay, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/pmirGLO-Bmpr2-1719+(Plasmid+%2349379)/bio_rxiv__2025__11__21__689335-78-11-18
    Average 93 stars, based on 1 article reviews
    mir sensor assay - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis.
    Article Snippet: .. The identified BMPR2 variants were introduced into the BMPR2 coding sequence (no. 116718, Addgene) by a simple 1- step PCR amplification with nonoverlapping primers (Q5 SiteDirected Mutagenesis Kit, New England Biolabs, Ipswich, MA). .. Primers were designed using the NEBaseChanger tool and purchased from IDT.

    Polymerase Chain Reaction:

    Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis.
    Article Snippet: .. The identified BMPR2 variants were introduced into the BMPR2 coding sequence (no. 116718, Addgene) by a simple 1- step PCR amplification with nonoverlapping primers (Q5 SiteDirected Mutagenesis Kit, New England Biolabs, Ipswich, MA). .. Primers were designed using the NEBaseChanger tool and purchased from IDT.

    Amplification:

    Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis.
    Article Snippet: .. The identified BMPR2 variants were introduced into the BMPR2 coding sequence (no. 116718, Addgene) by a simple 1- step PCR amplification with nonoverlapping primers (Q5 SiteDirected Mutagenesis Kit, New England Biolabs, Ipswich, MA). .. Primers were designed using the NEBaseChanger tool and purchased from IDT.

    Mutagenesis:

    Article Title: BMPR2 as a Novel Predisposition Gene for Hereditary Colorectal Polyposis.
    Article Snippet: .. The identified BMPR2 variants were introduced into the BMPR2 coding sequence (no. 116718, Addgene) by a simple 1- step PCR amplification with nonoverlapping primers (Q5 SiteDirected Mutagenesis Kit, New England Biolabs, Ipswich, MA). .. Primers were designed using the NEBaseChanger tool and purchased from IDT.

    Plasmid Preparation:

    Article Title: MIR17HG Expression Is Transcriptionally Regulated by PAX3::FOXO1 and MYCN and is Necessary for Oncogenic Activity in Fusion-Positive Rhabdomyosarcoma
    Article Snippet: .. To evaluate the efficacy of the miRNA-sponges , we used the miR-sensor assay ( ) in pmirGLO vector (Addgene plasmid #49379). ..

    Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension
    Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Promega CS173601 pGL4.15[luc2P/BMPR2/Hygro] Promega custom pRL-TK Renilla luciferase Promega custom PPARg expression plasmid Addgene 8895 DLL4 expression plasmid Origene custom ..

    Microarray:

    Article Title: BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Normal donkey serum Sigma Cat#D9663 Rat anti-ER-TR7 Abcam Cat#ab51824, RRID:AB_881651 Rabbit Anti-GFP Invitrogen Cat#A11122, RRID:AB_221569 Rabbit Anti-Eomes/Tbr2 Abcam Cat#ab23345, RRID:AB_778267 Mouse Anti-Tbx21 Abcam Cat#ab91109, RRID:AB_2050371 Alexa 488-conjugated donkey anti-rat IgG Thermo Fisher Scientific Cat# A-21208; RRID:AB_2536180 Alexa 488-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-21206; RRID:AB_2536180 Alexa 555-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-31572; RRID:AB_2536180 Alexa 555-conjugated donkey anti-mouse IgG Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 Chemicals, peptides, and recombinant proteins Paraformaldehyde Nacalai Tesque Cat# 26126-25 Low-melting point agarose Thermo Fisher Scientific Cat# 16520-100 OCT compound Sakura Ca# 4583 Saponin Nacalai Tesque Cat# 30502-42 Omnipaque 350 Daiichi-Sankyo N/A DAPI solution DOJINDO Cat# D523 Nembutal Dainippon Sumitomo Pharma N/A Somnopentyl Kyoritsu Seiyaku N/A Ketamine Daiichi-Sankyo N/A Xylazine Bayer N/A RNeasy Plus Mini Kit Quiagen Cat# 74134 SuperScript IV Thermo Fisher Scientific Cat#18090010 Oligo(dT)20 primer Invitrogen Cat#18418020 Low Input Quick Amp Gene Expression Labeling Kits Agilent Cat#5190-2331 SuperPrint G3 Mouse GE 8x60K Microarray Kit Ver 2.0 Agilent Cat# G4852 PowerUP SYBR Green Master Mix Thermo Fisher Scientific Cat# A25742 NMDA Nacalai Cat#22034-1 Glycine Sigma Cat#G7126-100G AP5 Sigma Cat# A5282 AMPA TOCRIS Cat#0169 TTX Abcam Cat# ab120055 Alexa Fluor 555 Tyramide Reagent Thermo Fisher Scientific Cat#B40955 Critical commercial assays RNA scope probe Bmp2 Advanced Cell Diagnostics Cat#406661 RNA scope probe Bmp4 Advanced Cell Diagnostics Cat#401301 RNA scope 2.5HD Reagent kit Brown Advanced Cell Diagnostics Cat#322300 Deposited data Raw image data This paper https://doi.org/10.24631/ssbd. repos.2021.04.001 Neurolucida tracing data This paper http://neuromorpho.org/ (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Microarray data This paper https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE171875 Experimental models: organisms/strains ICR mice Japan SLC RRID:MGI:5462094 C57BL/6N mice Japan SLC RRID:MGI:5295404 Thy1-GCaMP6f (C57BL/6J-Tg(Thy1GCaMP6f)GP5.11Dkim/J) The Jackson Laboratory Cat# JAX:024339; RRID:IMSR_JAX:024339 Oligonucleotides Thy1-GCaMP6f genotyping primer, forward: CTGACTGAAGAGCAGATCGCAGAAT Dana et al., 2014 N/A Thy1-GCaMP6f genotyping primer, reverse: GCAGCGTATCCACATAGCGTAAAAG Dana et al., 2014 N/A qPCR primers This paper, See Table S5 N/A Recombinant DNA pCAG-FLPo Fujimoto et al., 2019 Addgene # 125576 pCAFNF-tdTomato Fujimoto et al., 2019 Addgene # 125575 pCAX-Cas9 Tsunekawa et al., 2016 Gift from Dr. Matsuzaki Bmpr2 gRNA#1 This paper Addgene # 163388 Bmpr2 gRNA#2 This paper Addgene # 163389 Bmpr2 gRNA#3 This paper Addgene # 163390 pCAG-Bmpr2 This paper Addgene # 163408 pCAG-Bmpr2DKinase This paper Addgene # 163411 pCAG-Bmpr2DTail This paper Addgene # 163412 pCAG-Bmpr2DEC This paper Addgene # 163413 pCAG-Limk1 This paper Addgene # 163414 pCAG-Bmpr2 This paper Addgene # 163403 pCAG-Bmpr2DKinase This paper Addgene # 163404 pCAG-Bmpr2DTail This paper Addgene # 163405 pCAG-Bmpr2DEC This paper Addgene # 163406 pCAG-Noggin This paper Addgene # 163586 pCAG-Bmp2 This paper Addgene # 163587 pCAG-Bmp4 This paper Addgene # 163588 pCAG-Bmp5 This paper Addgene # 163589 pCAG-Bmp6 This paper Addgene # 163590 pCAG-Bmp7 This paper Addgene # 163591 pCAG-Bmp8a This paper Addgene # 163592 pCAG-Bmp15 This paper Addgene # 163594 pCAG-Gdf5 This paper Addgene # 163596 pCAG-Gdf6 This paper Addgene # 163598 pCAG-Gdf7 This paper Addgene # 163597 pCAG-Gdf9 This paper Addgene # 163599 pCAFNF-Rhoa This paper Addgene # 163605 pCAFNF-Cdc42 This paper Addgene # 163606 pCAFNF-Rac1 This paper Addgene # 163607 Limk1 gRNA#1 This paper Addgene # 163391 Limk1 gRNA#2 This paper Addgene # 163392 Limk1 gRNA#3 This paper Addgene # 163393 pCAG-Pak1 This paper Addgene # 163600 pCAGGS-RaichuEV-Rac1 Komatsu et al., 2011 Gift from Dr. Aoki (Continued on next page) e2 Cell Reports 35, 109276, June 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAG-RaichuEV-Rac1 (T17N) This paper Addgene # 164902 pCAG-rtTA This paper Addgene # 163601 pBS-TRE-mTurquoise2-WPRE Sakaguchi et al., 2018 Addgene # 104103 pBS-TRE-cofilin1(S3A)-P2A-mTurquoise2 This paper Addgene # 163610 Slingshot1 gRNA#1 This paper Addgene # 163394 Slingshot1 gRNA#2 This paper Addgene # 163395 Slingshot1 gRNA#3 This paper Addgene # 163396 Slingshot2 gRNA#1 This paper Addgene # 163397 Slingshot2 gRNA#2 This paper Addgene # 163398 Slingshot2 gRNA#3 This paper Addgene # 163399 Slingshot3 gRNA#1 This paper Addgene # 163400 Slingshot3 gRNA#2 This paper Addgene # 163401 Slingshot3 gRNA#3 This paper Addgene # 163402 pCAG-Slingshot1 This paper Addgene # 163602 Grin1 gRNA#1 This paper Addgene # 169789 Grin1 gRNA#2 This paper Addgene # 169790 Grin1 gRNA#3 This paper Addgene # 169791 pCAFNF-ECFP-actin This paper Addgene # 169787 pCAFNF-Venus-actin This paper Addgene # 169788 pCAFNF-LifeAct-EGFP This paper Addgene # 163608 pCAFNF-EGFP This paper Addgene # 163609 Eomes gRNA#1 This paper Addgene # 170834 Eomes gRNA#2 This paper Addgene # 170835 Eomes gRNA#3 This paper Addgene # 170836 Tbx21 gRNA#1 This paper Addgene # 170837 Tbx21 gRNA#2 This paper Addgene # 170838 Tbx21 gRNA#3 This paper Addgene # 170839 pCAFNF-PSDD1.2-EGFP Fujimoto et al., 2019 Addgene # 125581 pCAG-Bmpr2D751-813aa This paper Addgene # 163603 Bax gRNA#1 This paper Addgene # 171827 Bax gRNA#2 This paper Addgene # 171828 Bax gRNA#3 This paper Addgene # 171829 pCAG-cofilin S3A This paper Addgene # 163604 Software and algorithms ImageJ https://imagej.nih.gov/ij/ RRID:SCR_003070 Neurolucida MBF Bioscience RRID:SCR_001775 Huygens software Scientific Volume Imaging RRID:SCR_014237 Prism7 GraphPad RRID:SCR_002798 Leica Application Suite X Leica RRID:SCR_013673 Olympus Fluoview FV10-ASW Olympus RRID:SCR_014215 Other Electroporator BEX Cat# CUY21EX Forceps-type electrodes BEX Cat# LF650P3 Microslicer Dosaka Cat# PRO7 Cryostat Leica Cat# CM3050S Confocal microscope SP8 Leica N/A ABI7500 Applied Biosystems N/A FV1000MPE Olympus N/A Insight DS Dual Spectra-Physics N/A (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e3

    Real-time Polymerase Chain Reaction:

    Article Title: BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Normal donkey serum Sigma Cat#D9663 Rat anti-ER-TR7 Abcam Cat#ab51824, RRID:AB_881651 Rabbit Anti-GFP Invitrogen Cat#A11122, RRID:AB_221569 Rabbit Anti-Eomes/Tbr2 Abcam Cat#ab23345, RRID:AB_778267 Mouse Anti-Tbx21 Abcam Cat#ab91109, RRID:AB_2050371 Alexa 488-conjugated donkey anti-rat IgG Thermo Fisher Scientific Cat# A-21208; RRID:AB_2536180 Alexa 488-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-21206; RRID:AB_2536180 Alexa 555-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-31572; RRID:AB_2536180 Alexa 555-conjugated donkey anti-mouse IgG Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 Chemicals, peptides, and recombinant proteins Paraformaldehyde Nacalai Tesque Cat# 26126-25 Low-melting point agarose Thermo Fisher Scientific Cat# 16520-100 OCT compound Sakura Ca# 4583 Saponin Nacalai Tesque Cat# 30502-42 Omnipaque 350 Daiichi-Sankyo N/A DAPI solution DOJINDO Cat# D523 Nembutal Dainippon Sumitomo Pharma N/A Somnopentyl Kyoritsu Seiyaku N/A Ketamine Daiichi-Sankyo N/A Xylazine Bayer N/A RNeasy Plus Mini Kit Quiagen Cat# 74134 SuperScript IV Thermo Fisher Scientific Cat#18090010 Oligo(dT)20 primer Invitrogen Cat#18418020 Low Input Quick Amp Gene Expression Labeling Kits Agilent Cat#5190-2331 SuperPrint G3 Mouse GE 8x60K Microarray Kit Ver 2.0 Agilent Cat# G4852 PowerUP SYBR Green Master Mix Thermo Fisher Scientific Cat# A25742 NMDA Nacalai Cat#22034-1 Glycine Sigma Cat#G7126-100G AP5 Sigma Cat# A5282 AMPA TOCRIS Cat#0169 TTX Abcam Cat# ab120055 Alexa Fluor 555 Tyramide Reagent Thermo Fisher Scientific Cat#B40955 Critical commercial assays RNA scope probe Bmp2 Advanced Cell Diagnostics Cat#406661 RNA scope probe Bmp4 Advanced Cell Diagnostics Cat#401301 RNA scope 2.5HD Reagent kit Brown Advanced Cell Diagnostics Cat#322300 Deposited data Raw image data This paper https://doi.org/10.24631/ssbd. repos.2021.04.001 Neurolucida tracing data This paper http://neuromorpho.org/ (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Microarray data This paper https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE171875 Experimental models: organisms/strains ICR mice Japan SLC RRID:MGI:5462094 C57BL/6N mice Japan SLC RRID:MGI:5295404 Thy1-GCaMP6f (C57BL/6J-Tg(Thy1GCaMP6f)GP5.11Dkim/J) The Jackson Laboratory Cat# JAX:024339; RRID:IMSR_JAX:024339 Oligonucleotides Thy1-GCaMP6f genotyping primer, forward: CTGACTGAAGAGCAGATCGCAGAAT Dana et al., 2014 N/A Thy1-GCaMP6f genotyping primer, reverse: GCAGCGTATCCACATAGCGTAAAAG Dana et al., 2014 N/A qPCR primers This paper, See Table S5 N/A Recombinant DNA pCAG-FLPo Fujimoto et al., 2019 Addgene # 125576 pCAFNF-tdTomato Fujimoto et al., 2019 Addgene # 125575 pCAX-Cas9 Tsunekawa et al., 2016 Gift from Dr. Matsuzaki Bmpr2 gRNA#1 This paper Addgene # 163388 Bmpr2 gRNA#2 This paper Addgene # 163389 Bmpr2 gRNA#3 This paper Addgene # 163390 pCAG-Bmpr2 This paper Addgene # 163408 pCAG-Bmpr2DKinase This paper Addgene # 163411 pCAG-Bmpr2DTail This paper Addgene # 163412 pCAG-Bmpr2DEC This paper Addgene # 163413 pCAG-Limk1 This paper Addgene # 163414 pCAG-Bmpr2 This paper Addgene # 163403 pCAG-Bmpr2DKinase This paper Addgene # 163404 pCAG-Bmpr2DTail This paper Addgene # 163405 pCAG-Bmpr2DEC This paper Addgene # 163406 pCAG-Noggin This paper Addgene # 163586 pCAG-Bmp2 This paper Addgene # 163587 pCAG-Bmp4 This paper Addgene # 163588 pCAG-Bmp5 This paper Addgene # 163589 pCAG-Bmp6 This paper Addgene # 163590 pCAG-Bmp7 This paper Addgene # 163591 pCAG-Bmp8a This paper Addgene # 163592 pCAG-Bmp15 This paper Addgene # 163594 pCAG-Gdf5 This paper Addgene # 163596 pCAG-Gdf6 This paper Addgene # 163598 pCAG-Gdf7 This paper Addgene # 163597 pCAG-Gdf9 This paper Addgene # 163599 pCAFNF-Rhoa This paper Addgene # 163605 pCAFNF-Cdc42 This paper Addgene # 163606 pCAFNF-Rac1 This paper Addgene # 163607 Limk1 gRNA#1 This paper Addgene # 163391 Limk1 gRNA#2 This paper Addgene # 163392 Limk1 gRNA#3 This paper Addgene # 163393 pCAG-Pak1 This paper Addgene # 163600 pCAGGS-RaichuEV-Rac1 Komatsu et al., 2011 Gift from Dr. Aoki (Continued on next page) e2 Cell Reports 35, 109276, June 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAG-RaichuEV-Rac1 (T17N) This paper Addgene # 164902 pCAG-rtTA This paper Addgene # 163601 pBS-TRE-mTurquoise2-WPRE Sakaguchi et al., 2018 Addgene # 104103 pBS-TRE-cofilin1(S3A)-P2A-mTurquoise2 This paper Addgene # 163610 Slingshot1 gRNA#1 This paper Addgene # 163394 Slingshot1 gRNA#2 This paper Addgene # 163395 Slingshot1 gRNA#3 This paper Addgene # 163396 Slingshot2 gRNA#1 This paper Addgene # 163397 Slingshot2 gRNA#2 This paper Addgene # 163398 Slingshot2 gRNA#3 This paper Addgene # 163399 Slingshot3 gRNA#1 This paper Addgene # 163400 Slingshot3 gRNA#2 This paper Addgene # 163401 Slingshot3 gRNA#3 This paper Addgene # 163402 pCAG-Slingshot1 This paper Addgene # 163602 Grin1 gRNA#1 This paper Addgene # 169789 Grin1 gRNA#2 This paper Addgene # 169790 Grin1 gRNA#3 This paper Addgene # 169791 pCAFNF-ECFP-actin This paper Addgene # 169787 pCAFNF-Venus-actin This paper Addgene # 169788 pCAFNF-LifeAct-EGFP This paper Addgene # 163608 pCAFNF-EGFP This paper Addgene # 163609 Eomes gRNA#1 This paper Addgene # 170834 Eomes gRNA#2 This paper Addgene # 170835 Eomes gRNA#3 This paper Addgene # 170836 Tbx21 gRNA#1 This paper Addgene # 170837 Tbx21 gRNA#2 This paper Addgene # 170838 Tbx21 gRNA#3 This paper Addgene # 170839 pCAFNF-PSDD1.2-EGFP Fujimoto et al., 2019 Addgene # 125581 pCAG-Bmpr2D751-813aa This paper Addgene # 163603 Bax gRNA#1 This paper Addgene # 171827 Bax gRNA#2 This paper Addgene # 171828 Bax gRNA#3 This paper Addgene # 171829 pCAG-cofilin S3A This paper Addgene # 163604 Software and algorithms ImageJ https://imagej.nih.gov/ij/ RRID:SCR_003070 Neurolucida MBF Bioscience RRID:SCR_001775 Huygens software Scientific Volume Imaging RRID:SCR_014237 Prism7 GraphPad RRID:SCR_002798 Leica Application Suite X Leica RRID:SCR_013673 Olympus Fluoview FV10-ASW Olympus RRID:SCR_014215 Other Electroporator BEX Cat# CUY21EX Forceps-type electrodes BEX Cat# LF650P3 Microslicer Dosaka Cat# PRO7 Cryostat Leica Cat# CM3050S Confocal microscope SP8 Leica N/A ABI7500 Applied Biosystems N/A FV1000MPE Olympus N/A Insight DS Dual Spectra-Physics N/A (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e3

    Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension
    Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Promega CS173601 pGL4.15[luc2P/BMPR2/Hygro] Promega custom pRL-TK Renilla luciferase Promega custom PPARg expression plasmid Addgene 8895 DLL4 expression plasmid Origene custom ..

    Recombinant:

    Article Title: BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Normal donkey serum Sigma Cat#D9663 Rat anti-ER-TR7 Abcam Cat#ab51824, RRID:AB_881651 Rabbit Anti-GFP Invitrogen Cat#A11122, RRID:AB_221569 Rabbit Anti-Eomes/Tbr2 Abcam Cat#ab23345, RRID:AB_778267 Mouse Anti-Tbx21 Abcam Cat#ab91109, RRID:AB_2050371 Alexa 488-conjugated donkey anti-rat IgG Thermo Fisher Scientific Cat# A-21208; RRID:AB_2536180 Alexa 488-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-21206; RRID:AB_2536180 Alexa 555-conjugated donkey anti-rabbit IgG Thermo Fisher Scientific Cat# A-31572; RRID:AB_2536180 Alexa 555-conjugated donkey anti-mouse IgG Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 Chemicals, peptides, and recombinant proteins Paraformaldehyde Nacalai Tesque Cat# 26126-25 Low-melting point agarose Thermo Fisher Scientific Cat# 16520-100 OCT compound Sakura Ca# 4583 Saponin Nacalai Tesque Cat# 30502-42 Omnipaque 350 Daiichi-Sankyo N/A DAPI solution DOJINDO Cat# D523 Nembutal Dainippon Sumitomo Pharma N/A Somnopentyl Kyoritsu Seiyaku N/A Ketamine Daiichi-Sankyo N/A Xylazine Bayer N/A RNeasy Plus Mini Kit Quiagen Cat# 74134 SuperScript IV Thermo Fisher Scientific Cat#18090010 Oligo(dT)20 primer Invitrogen Cat#18418020 Low Input Quick Amp Gene Expression Labeling Kits Agilent Cat#5190-2331 SuperPrint G3 Mouse GE 8x60K Microarray Kit Ver 2.0 Agilent Cat# G4852 PowerUP SYBR Green Master Mix Thermo Fisher Scientific Cat# A25742 NMDA Nacalai Cat#22034-1 Glycine Sigma Cat#G7126-100G AP5 Sigma Cat# A5282 AMPA TOCRIS Cat#0169 TTX Abcam Cat# ab120055 Alexa Fluor 555 Tyramide Reagent Thermo Fisher Scientific Cat#B40955 Critical commercial assays RNA scope probe Bmp2 Advanced Cell Diagnostics Cat#406661 RNA scope probe Bmp4 Advanced Cell Diagnostics Cat#401301 RNA scope 2.5HD Reagent kit Brown Advanced Cell Diagnostics Cat#322300 Deposited data Raw image data This paper https://doi.org/10.24631/ssbd. repos.2021.04.001 Neurolucida tracing data This paper http://neuromorpho.org/ (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Microarray data This paper https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE171875 Experimental models: organisms/strains ICR mice Japan SLC RRID:MGI:5462094 C57BL/6N mice Japan SLC RRID:MGI:5295404 Thy1-GCaMP6f (C57BL/6J-Tg(Thy1GCaMP6f)GP5.11Dkim/J) The Jackson Laboratory Cat# JAX:024339; RRID:IMSR_JAX:024339 Oligonucleotides Thy1-GCaMP6f genotyping primer, forward: CTGACTGAAGAGCAGATCGCAGAAT Dana et al., 2014 N/A Thy1-GCaMP6f genotyping primer, reverse: GCAGCGTATCCACATAGCGTAAAAG Dana et al., 2014 N/A qPCR primers This paper, See Table S5 N/A Recombinant DNA pCAG-FLPo Fujimoto et al., 2019 Addgene # 125576 pCAFNF-tdTomato Fujimoto et al., 2019 Addgene # 125575 pCAX-Cas9 Tsunekawa et al., 2016 Gift from Dr. Matsuzaki Bmpr2 gRNA#1 This paper Addgene # 163388 Bmpr2 gRNA#2 This paper Addgene # 163389 Bmpr2 gRNA#3 This paper Addgene # 163390 pCAG-Bmpr2 This paper Addgene # 163408 pCAG-Bmpr2DKinase This paper Addgene # 163411 pCAG-Bmpr2DTail This paper Addgene # 163412 pCAG-Bmpr2DEC This paper Addgene # 163413 pCAG-Limk1 This paper Addgene # 163414 pCAG-Bmpr2 This paper Addgene # 163403 pCAG-Bmpr2DKinase This paper Addgene # 163404 pCAG-Bmpr2DTail This paper Addgene # 163405 pCAG-Bmpr2DEC This paper Addgene # 163406 pCAG-Noggin This paper Addgene # 163586 pCAG-Bmp2 This paper Addgene # 163587 pCAG-Bmp4 This paper Addgene # 163588 pCAG-Bmp5 This paper Addgene # 163589 pCAG-Bmp6 This paper Addgene # 163590 pCAG-Bmp7 This paper Addgene # 163591 pCAG-Bmp8a This paper Addgene # 163592 pCAG-Bmp15 This paper Addgene # 163594 pCAG-Gdf5 This paper Addgene # 163596 pCAG-Gdf6 This paper Addgene # 163598 pCAG-Gdf7 This paper Addgene # 163597 pCAG-Gdf9 This paper Addgene # 163599 pCAFNF-Rhoa This paper Addgene # 163605 pCAFNF-Cdc42 This paper Addgene # 163606 pCAFNF-Rac1 This paper Addgene # 163607 Limk1 gRNA#1 This paper Addgene # 163391 Limk1 gRNA#2 This paper Addgene # 163392 Limk1 gRNA#3 This paper Addgene # 163393 pCAG-Pak1 This paper Addgene # 163600 pCAGGS-RaichuEV-Rac1 Komatsu et al., 2011 Gift from Dr. Aoki (Continued on next page) e2 Cell Reports 35, 109276, June 22, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAG-RaichuEV-Rac1 (T17N) This paper Addgene # 164902 pCAG-rtTA This paper Addgene # 163601 pBS-TRE-mTurquoise2-WPRE Sakaguchi et al., 2018 Addgene # 104103 pBS-TRE-cofilin1(S3A)-P2A-mTurquoise2 This paper Addgene # 163610 Slingshot1 gRNA#1 This paper Addgene # 163394 Slingshot1 gRNA#2 This paper Addgene # 163395 Slingshot1 gRNA#3 This paper Addgene # 163396 Slingshot2 gRNA#1 This paper Addgene # 163397 Slingshot2 gRNA#2 This paper Addgene # 163398 Slingshot2 gRNA#3 This paper Addgene # 163399 Slingshot3 gRNA#1 This paper Addgene # 163400 Slingshot3 gRNA#2 This paper Addgene # 163401 Slingshot3 gRNA#3 This paper Addgene # 163402 pCAG-Slingshot1 This paper Addgene # 163602 Grin1 gRNA#1 This paper Addgene # 169789 Grin1 gRNA#2 This paper Addgene # 169790 Grin1 gRNA#3 This paper Addgene # 169791 pCAFNF-ECFP-actin This paper Addgene # 169787 pCAFNF-Venus-actin This paper Addgene # 169788 pCAFNF-LifeAct-EGFP This paper Addgene # 163608 pCAFNF-EGFP This paper Addgene # 163609 Eomes gRNA#1 This paper Addgene # 170834 Eomes gRNA#2 This paper Addgene # 170835 Eomes gRNA#3 This paper Addgene # 170836 Tbx21 gRNA#1 This paper Addgene # 170837 Tbx21 gRNA#2 This paper Addgene # 170838 Tbx21 gRNA#3 This paper Addgene # 170839 pCAFNF-PSDD1.2-EGFP Fujimoto et al., 2019 Addgene # 125581 pCAG-Bmpr2D751-813aa This paper Addgene # 163603 Bax gRNA#1 This paper Addgene # 171827 Bax gRNA#2 This paper Addgene # 171828 Bax gRNA#3 This paper Addgene # 171829 pCAG-cofilin S3A This paper Addgene # 163604 Software and algorithms ImageJ https://imagej.nih.gov/ij/ RRID:SCR_003070 Neurolucida MBF Bioscience RRID:SCR_001775 Huygens software Scientific Volume Imaging RRID:SCR_014237 Prism7 GraphPad RRID:SCR_002798 Leica Application Suite X Leica RRID:SCR_013673 Olympus Fluoview FV10-ASW Olympus RRID:SCR_014215 Other Electroporator BEX Cat# CUY21EX Forceps-type electrodes BEX Cat# LF650P3 Microslicer Dosaka Cat# PRO7 Cryostat Leica Cat# CM3050S Confocal microscope SP8 Leica N/A ABI7500 Applied Biosystems N/A FV1000MPE Olympus N/A Insight DS Dual Spectra-Physics N/A (Continued on next page) Cell Reports 35, 109276, June 22, 2021 e3

    Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension
    Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Promega CS173601 pGL4.15[luc2P/BMPR2/Hygro] Promega custom pRL-TK Renilla luciferase Promega custom PPARg expression plasmid Addgene 8895 DLL4 expression plasmid Origene custom ..

    Luciferase:

    Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension
    Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Promega CS173601 pGL4.15[luc2P/BMPR2/Hygro] Promega custom pRL-TK Renilla luciferase Promega custom PPARg expression plasmid Addgene 8895 DLL4 expression plasmid Origene custom ..

    Expressing:

    Article Title: Disruption of DLL4/NOTCH1 Causes Dysregulated PPARγ/AKT Signaling in Pulmonary Arterial Hypertension
    Article Snippet: EGM-2 BulletKit (CC-3156 & CC4176) Lonza CC-3162 EGM-2 MV BulletKit (CC-3156 & CC-4177) Lonza CC-3202 Opti-MEM Gibco 31985077 Critical commercial assays Caspase-Glo 3/7 Promega G8093 FITC Annexin V Apoptosis Detection Kit BD Pharmingen 556547 Cell Proliferation ELISA, BrdU (chemiluminescent) Sigma 11669915001 NE-PER Nuclear and Cytoplasmic Extraction kit ThermoFisher Scientific 78835 LipofectamineTM Stem reagent ThermoFisher Scientific STEM00001 iScriptTM cDNA Synthesis Kit Bio-Rad 170-8891 iTaqTM Universal SYBR® Green Supermix Bio-Rad 1725124 .. Primers for qPCR, see Table S2 Recombinant DNA Vector PPRE3-TK-LUC; 3 copies of PPRE upstream of the thymidine kinase promoter fused to the luciferase gene Kindly provided by Ronald M. Evans pGL4[luc2P/RBP-Jk-RE/Hygro] Promega CS173601 pGL4.15[luc2P/BMPR2/Hygro] Promega custom pRL-TK Renilla luciferase Promega custom PPARg expression plasmid Addgene 8895 DLL4 expression plasmid Origene custom ..



    Similar Products

    93
    Sino Biological human bmprii protein
    Human Bmprii Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/Human+BMPR2+%2F+BMPR-II+Protein/us12473367-985-12-15
    Average 93 stars, based on 1 article reviews
    human bmprii protein - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    98
    Thermo Fisher gene exp bmpr2 hs00176148 m1
    Gene Exp Bmpr2 Hs00176148 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/Gene+Exp%2E+BMPR2%2C+Hs00176148_m1/us12600952-125-59-62
    Average 98 stars, based on 1 article reviews
    gene exp bmpr2 hs00176148 m1 - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    86
    Exosome Diagnostics bmpr2 elpcs
    Bmpr2 Elpcs, supplied by Exosome Diagnostics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/bmpr2+elpcs/pmc13060647-27-0-24
    Average 86 stars, based on 1 article reviews
    bmpr2 elpcs - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    94
    Cell Signaling Technology Inc bmpr2
    BMP4 activates <t>BMPR2/Smad</t> signaling to induce macrophage M2 polarization. (A) PCA analysis of macrophages were treated with sEV-derived CAF-S6 transfected with shNC and shPOSTN in three replicate times. (B) Venn-diagram of DEGs between shPOSTN sEV vs. CTRL and shPOSTN sEVs vs. shNC sEVs. (C) Heatmap showing the top DEGs in each group. (D) Volcano plot showing BMP4 downregulation in macrophages treated with shPOSTN sEVs vs. shNC sEVs. (E) GSEA analysis of hallmark pathways in macrophages treated with sEV-derived CAF-S6 transfected with either shPOSTN or shNC. (F) GO enrichment analysis was performed to identify pathways associated with the representative DEGs. (G) The bubble plot displays the top 20 markedly enriched KEGG pathways for the DEGs. (H) The mRNA expression of BMP4 in macrophages induced sEVs derived from CAF-S5/-S6 transfected with shNC and shPOSTN were analyzed by RT-qPCR. (I) The mRNA expression of TNF-α, IL-6, TGF-β and IL-10 in macrophages stimulated with BMP4 at concentrations of 0, 50 and 100 ng/ml. (J) The expression of CD163 and CD206 in macrophages treated with BMP4 at concentrations of 0, 100 ng/ml examined by flow cytometry. (K) The level of BMPR2, pSmad1/5/9, Smad 5 and Smad 9 in macrophages treated with BMP4 (100 ng/ml) for 48 h were examined by western blotting (n=3 per group). (L) The level of pSmad1/5/9, Smad5, Smad9, CD163 and CD206 in macrophages treatment with or without LDN193189 inhibitor (n=3 per group). Statistical significance was determined using a one-way ANOVA test, ns, not significant *P<0.05; **P<0.01; ****P<0.0001. Error bars represent the mean ± SEM. Source data for blotting assays, see . PCA, principal component analysis; sEV, small extracellular vesicles; sh, short hairpin; NC, negative control; DEGs, differentially expressed genes; POSTN, perostin; sEV, small extracellular vesicles; GSEA, gene set enrichment analysis; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; RT-qPCR, reverse transcription-quantitative PCR; pSmad, phosphorylated Smad.
    Bmpr2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/Tofacitinib/pmc12891935-155-54-68
    Average 94 stars, based on 1 article reviews
    bmpr2 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    86
    Dawley Inc bmpr2 δ71 female sprague dawley rats
    <t>BMPR2</t> (bone morphogenetic protein receptor type 2) is associated with pulmonary hypertension and breast cancer. A , Bioinformatic analysis reveals that BMPR2 is associated with 14 pulmonary arterial hypertension–related disease terms, 5 breast cancer–related disease terms, hyperandrogenism, and 2-oxo-hept-3-ene-1,7-dioate hydratase activity. B , Distribution of rare, predicted deleterious BMPR2 variants identified in breast tumors, including missense, nonsense, frameshift deletion, and insertion mutations from cBioPortal. The pulmonary arterial hypertension (PAH)–associated G83R variant is indicated. C , Copy number alteration (CNA) analysis of BMPR2 from cBioPortal breast cancer datasets (n=2599). Of 76 samples with copy number alterations, 92% were deep deletions and 8% amplifications. D , Violin plot depicting the distribution of BMPR2 log2 standardized mRNA levels across different breast cancer subtypes (basal-like, HER2-E, luminal A, and luminal B) and normal breast–like tissue. Embedded box plots represent the median (horizontal line) and interquartile range (box boundaries). Sample sizes for each group are indicated in parentheses. One-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons: ** P <0.01, **** P <0.0001. E , Quantification and representative immunofluorescence images showing decreased BMPRII protein expression in breast carcinoma compared with normal mammary gland tissue in human. Each dot represents a distinct patient, with values corresponding to the average signal from 8 mammary gland regions (n=4 non–breast cancer control, n=19 breast carcinoma). Unpaired t test. *** P <0.005. F through J , spontaneous mammary tumor development over time in Bmpr2-mutated ( Bmpr2 <t>+/Δ71</t> ) and wild-type ( Bmpr2 +/+ ) rats. F , Kaplan-Meier curve showing the tumor-free cumulative risk in Bmpr2 +/Δ71 rats (red line) compared with Bmpr2 +/+ animals (black line) over time. Numbers at risk for each group are shown below the plot. G , Bar graph summarizing the percentage of rats with or without tumors at the end point. Bmpr2 +/Δ71 rats show a significantly higher tumor incidence (14%) compared with Bmpr2 +/+ controls (2%). Z score, n=71 Bmpr2 +/Δ71 and 45 Bmpr2 +/+ rats. H , Macroscopic and histological analysis of mammary tumors in Bmpr2 +/Δ71 rats. The representative macroscopic image ( left ) shows large tumor masses compared with healthy tissue. Histological sections depict healthy mammary tissue, fibroadenoma, and adenocarcinoma, stained with hematoxylin-eosin (H&E). Scale bars: 200 μm ( top ) and 50 μm ( bottom ). I , Correlation analysis between BMPR2 and BRCA1 expression in rat mammary tissue, showing a strong positive association (Pearson r=0.857, P <0.0001). J , Representative immunofluorescence staining of BMPR2 (green) and BRCA1 (magenta) in mammary glands from wild-type (WT) and Bmpr2 +/Δ71 rats. Scale bars: 50 μm. aa indicates amino acids; and A.U., arbitrary units.
    Bmpr2 δ71 Female Sprague Dawley Rats, supplied by Dawley Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/dawley+female+rats+sprague/pmc12908636-29-5-8
    Average 86 stars, based on 1 article reviews
    bmpr2 δ71 female sprague dawley rats - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    93
    Addgene inc mir sensor assay
    <t>BMPR2</t> (bone morphogenetic protein receptor type 2) is associated with pulmonary hypertension and breast cancer. A , Bioinformatic analysis reveals that BMPR2 is associated with 14 pulmonary arterial hypertension–related disease terms, 5 breast cancer–related disease terms, hyperandrogenism, and 2-oxo-hept-3-ene-1,7-dioate hydratase activity. B , Distribution of rare, predicted deleterious BMPR2 variants identified in breast tumors, including missense, nonsense, frameshift deletion, and insertion mutations from cBioPortal. The pulmonary arterial hypertension (PAH)–associated G83R variant is indicated. C , Copy number alteration (CNA) analysis of BMPR2 from cBioPortal breast cancer datasets (n=2599). Of 76 samples with copy number alterations, 92% were deep deletions and 8% amplifications. D , Violin plot depicting the distribution of BMPR2 log2 standardized mRNA levels across different breast cancer subtypes (basal-like, HER2-E, luminal A, and luminal B) and normal breast–like tissue. Embedded box plots represent the median (horizontal line) and interquartile range (box boundaries). Sample sizes for each group are indicated in parentheses. One-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons: ** P <0.01, **** P <0.0001. E , Quantification and representative immunofluorescence images showing decreased BMPRII protein expression in breast carcinoma compared with normal mammary gland tissue in human. Each dot represents a distinct patient, with values corresponding to the average signal from 8 mammary gland regions (n=4 non–breast cancer control, n=19 breast carcinoma). Unpaired t test. *** P <0.005. F through J , spontaneous mammary tumor development over time in Bmpr2-mutated ( Bmpr2 <t>+/Δ71</t> ) and wild-type ( Bmpr2 +/+ ) rats. F , Kaplan-Meier curve showing the tumor-free cumulative risk in Bmpr2 +/Δ71 rats (red line) compared with Bmpr2 +/+ animals (black line) over time. Numbers at risk for each group are shown below the plot. G , Bar graph summarizing the percentage of rats with or without tumors at the end point. Bmpr2 +/Δ71 rats show a significantly higher tumor incidence (14%) compared with Bmpr2 +/+ controls (2%). Z score, n=71 Bmpr2 +/Δ71 and 45 Bmpr2 +/+ rats. H , Macroscopic and histological analysis of mammary tumors in Bmpr2 +/Δ71 rats. The representative macroscopic image ( left ) shows large tumor masses compared with healthy tissue. Histological sections depict healthy mammary tissue, fibroadenoma, and adenocarcinoma, stained with hematoxylin-eosin (H&E). Scale bars: 200 μm ( top ) and 50 μm ( bottom ). I , Correlation analysis between BMPR2 and BRCA1 expression in rat mammary tissue, showing a strong positive association (Pearson r=0.857, P <0.0001). J , Representative immunofluorescence staining of BMPR2 (green) and BRCA1 (magenta) in mammary glands from wild-type (WT) and Bmpr2 +/Δ71 rats. Scale bars: 50 μm. aa indicates amino acids; and A.U., arbitrary units.
    Mir Sensor Assay, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/pmirGLO-Bmpr2-1719+(Plasmid+%2349379)/bio_rxiv__2025__11__21__689335-78-11-18
    Average 93 stars, based on 1 article reviews
    mir sensor assay - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology anti bmpr2 antibody
    <t>BMPR2</t> (bone morphogenetic protein receptor type 2) is associated with pulmonary hypertension and breast cancer. A , Bioinformatic analysis reveals that BMPR2 is associated with 14 pulmonary arterial hypertension–related disease terms, 5 breast cancer–related disease terms, hyperandrogenism, and 2-oxo-hept-3-ene-1,7-dioate hydratase activity. B , Distribution of rare, predicted deleterious BMPR2 variants identified in breast tumors, including missense, nonsense, frameshift deletion, and insertion mutations from cBioPortal. The pulmonary arterial hypertension (PAH)–associated G83R variant is indicated. C , Copy number alteration (CNA) analysis of BMPR2 from cBioPortal breast cancer datasets (n=2599). Of 76 samples with copy number alterations, 92% were deep deletions and 8% amplifications. D , Violin plot depicting the distribution of BMPR2 log2 standardized mRNA levels across different breast cancer subtypes (basal-like, HER2-E, luminal A, and luminal B) and normal breast–like tissue. Embedded box plots represent the median (horizontal line) and interquartile range (box boundaries). Sample sizes for each group are indicated in parentheses. One-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons: ** P <0.01, **** P <0.0001. E , Quantification and representative immunofluorescence images showing decreased BMPRII protein expression in breast carcinoma compared with normal mammary gland tissue in human. Each dot represents a distinct patient, with values corresponding to the average signal from 8 mammary gland regions (n=4 non–breast cancer control, n=19 breast carcinoma). Unpaired t test. *** P <0.005. F through J , spontaneous mammary tumor development over time in Bmpr2-mutated ( Bmpr2 <t>+/Δ71</t> ) and wild-type ( Bmpr2 +/+ ) rats. F , Kaplan-Meier curve showing the tumor-free cumulative risk in Bmpr2 +/Δ71 rats (red line) compared with Bmpr2 +/+ animals (black line) over time. Numbers at risk for each group are shown below the plot. G , Bar graph summarizing the percentage of rats with or without tumors at the end point. Bmpr2 +/Δ71 rats show a significantly higher tumor incidence (14%) compared with Bmpr2 +/+ controls (2%). Z score, n=71 Bmpr2 +/Δ71 and 45 Bmpr2 +/+ rats. H , Macroscopic and histological analysis of mammary tumors in Bmpr2 +/Δ71 rats. The representative macroscopic image ( left ) shows large tumor masses compared with healthy tissue. Histological sections depict healthy mammary tissue, fibroadenoma, and adenocarcinoma, stained with hematoxylin-eosin (H&E). Scale bars: 200 μm ( top ) and 50 μm ( bottom ). I , Correlation analysis between BMPR2 and BRCA1 expression in rat mammary tissue, showing a strong positive association (Pearson r=0.857, P <0.0001). J , Representative immunofluorescence staining of BMPR2 (green) and BRCA1 (magenta) in mammary glands from wild-type (WT) and Bmpr2 +/Δ71 rats. Scale bars: 50 μm. aa indicates amino acids; and A.U., arbitrary units.
    Anti Bmpr2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/BMPR-II+Antibody/pm41152257-301-18-22
    Average 93 stars, based on 1 article reviews
    anti bmpr2 antibody - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Proteintech bmpr2
    <t>BMPR2</t> (bone morphogenetic protein receptor type 2) is associated with pulmonary hypertension and breast cancer. A , Bioinformatic analysis reveals that BMPR2 is associated with 14 pulmonary arterial hypertension–related disease terms, 5 breast cancer–related disease terms, hyperandrogenism, and 2-oxo-hept-3-ene-1,7-dioate hydratase activity. B , Distribution of rare, predicted deleterious BMPR2 variants identified in breast tumors, including missense, nonsense, frameshift deletion, and insertion mutations from cBioPortal. The pulmonary arterial hypertension (PAH)–associated G83R variant is indicated. C , Copy number alteration (CNA) analysis of BMPR2 from cBioPortal breast cancer datasets (n=2599). Of 76 samples with copy number alterations, 92% were deep deletions and 8% amplifications. D , Violin plot depicting the distribution of BMPR2 log2 standardized mRNA levels across different breast cancer subtypes (basal-like, HER2-E, luminal A, and luminal B) and normal breast–like tissue. Embedded box plots represent the median (horizontal line) and interquartile range (box boundaries). Sample sizes for each group are indicated in parentheses. One-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons: ** P <0.01, **** P <0.0001. E , Quantification and representative immunofluorescence images showing decreased BMPRII protein expression in breast carcinoma compared with normal mammary gland tissue in human. Each dot represents a distinct patient, with values corresponding to the average signal from 8 mammary gland regions (n=4 non–breast cancer control, n=19 breast carcinoma). Unpaired t test. *** P <0.005. F through J , spontaneous mammary tumor development over time in Bmpr2-mutated ( Bmpr2 <t>+/Δ71</t> ) and wild-type ( Bmpr2 +/+ ) rats. F , Kaplan-Meier curve showing the tumor-free cumulative risk in Bmpr2 +/Δ71 rats (red line) compared with Bmpr2 +/+ animals (black line) over time. Numbers at risk for each group are shown below the plot. G , Bar graph summarizing the percentage of rats with or without tumors at the end point. Bmpr2 +/Δ71 rats show a significantly higher tumor incidence (14%) compared with Bmpr2 +/+ controls (2%). Z score, n=71 Bmpr2 +/Δ71 and 45 Bmpr2 +/+ rats. H , Macroscopic and histological analysis of mammary tumors in Bmpr2 +/Δ71 rats. The representative macroscopic image ( left ) shows large tumor masses compared with healthy tissue. Histological sections depict healthy mammary tissue, fibroadenoma, and adenocarcinoma, stained with hematoxylin-eosin (H&E). Scale bars: 200 μm ( top ) and 50 μm ( bottom ). I , Correlation analysis between BMPR2 and BRCA1 expression in rat mammary tissue, showing a strong positive association (Pearson r=0.857, P <0.0001). J , Representative immunofluorescence staining of BMPR2 (green) and BRCA1 (magenta) in mammary glands from wild-type (WT) and Bmpr2 +/Δ71 rats. Scale bars: 50 μm. aa indicates amino acids; and A.U., arbitrary units.
    Bmpr2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bmpr2/BMPR2+Antibody/pm40946915-98-12-15
    Average 93 stars, based on 1 article reviews
    bmpr2 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    Image Search Results


    BMP4 activates BMPR2/Smad signaling to induce macrophage M2 polarization. (A) PCA analysis of macrophages were treated with sEV-derived CAF-S6 transfected with shNC and shPOSTN in three replicate times. (B) Venn-diagram of DEGs between shPOSTN sEV vs. CTRL and shPOSTN sEVs vs. shNC sEVs. (C) Heatmap showing the top DEGs in each group. (D) Volcano plot showing BMP4 downregulation in macrophages treated with shPOSTN sEVs vs. shNC sEVs. (E) GSEA analysis of hallmark pathways in macrophages treated with sEV-derived CAF-S6 transfected with either shPOSTN or shNC. (F) GO enrichment analysis was performed to identify pathways associated with the representative DEGs. (G) The bubble plot displays the top 20 markedly enriched KEGG pathways for the DEGs. (H) The mRNA expression of BMP4 in macrophages induced sEVs derived from CAF-S5/-S6 transfected with shNC and shPOSTN were analyzed by RT-qPCR. (I) The mRNA expression of TNF-α, IL-6, TGF-β and IL-10 in macrophages stimulated with BMP4 at concentrations of 0, 50 and 100 ng/ml. (J) The expression of CD163 and CD206 in macrophages treated with BMP4 at concentrations of 0, 100 ng/ml examined by flow cytometry. (K) The level of BMPR2, pSmad1/5/9, Smad 5 and Smad 9 in macrophages treated with BMP4 (100 ng/ml) for 48 h were examined by western blotting (n=3 per group). (L) The level of pSmad1/5/9, Smad5, Smad9, CD163 and CD206 in macrophages treatment with or without LDN193189 inhibitor (n=3 per group). Statistical significance was determined using a one-way ANOVA test, ns, not significant *P<0.05; **P<0.01; ****P<0.0001. Error bars represent the mean ± SEM. Source data for blotting assays, see . PCA, principal component analysis; sEV, small extracellular vesicles; sh, short hairpin; NC, negative control; DEGs, differentially expressed genes; POSTN, perostin; sEV, small extracellular vesicles; GSEA, gene set enrichment analysis; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; RT-qPCR, reverse transcription-quantitative PCR; pSmad, phosphorylated Smad.

    Journal: Oncology Reports

    Article Title: POSTN + fibroblast-secreted small extracellular vesicles drive macrophage M2 polarization through BMP4/BMPR2/Smad signaling

    doi: 10.3892/or.2026.9067

    Figure Lengend Snippet: BMP4 activates BMPR2/Smad signaling to induce macrophage M2 polarization. (A) PCA analysis of macrophages were treated with sEV-derived CAF-S6 transfected with shNC and shPOSTN in three replicate times. (B) Venn-diagram of DEGs between shPOSTN sEV vs. CTRL and shPOSTN sEVs vs. shNC sEVs. (C) Heatmap showing the top DEGs in each group. (D) Volcano plot showing BMP4 downregulation in macrophages treated with shPOSTN sEVs vs. shNC sEVs. (E) GSEA analysis of hallmark pathways in macrophages treated with sEV-derived CAF-S6 transfected with either shPOSTN or shNC. (F) GO enrichment analysis was performed to identify pathways associated with the representative DEGs. (G) The bubble plot displays the top 20 markedly enriched KEGG pathways for the DEGs. (H) The mRNA expression of BMP4 in macrophages induced sEVs derived from CAF-S5/-S6 transfected with shNC and shPOSTN were analyzed by RT-qPCR. (I) The mRNA expression of TNF-α, IL-6, TGF-β and IL-10 in macrophages stimulated with BMP4 at concentrations of 0, 50 and 100 ng/ml. (J) The expression of CD163 and CD206 in macrophages treated with BMP4 at concentrations of 0, 100 ng/ml examined by flow cytometry. (K) The level of BMPR2, pSmad1/5/9, Smad 5 and Smad 9 in macrophages treated with BMP4 (100 ng/ml) for 48 h were examined by western blotting (n=3 per group). (L) The level of pSmad1/5/9, Smad5, Smad9, CD163 and CD206 in macrophages treatment with or without LDN193189 inhibitor (n=3 per group). Statistical significance was determined using a one-way ANOVA test, ns, not significant *P<0.05; **P<0.01; ****P<0.0001. Error bars represent the mean ± SEM. Source data for blotting assays, see . PCA, principal component analysis; sEV, small extracellular vesicles; sh, short hairpin; NC, negative control; DEGs, differentially expressed genes; POSTN, perostin; sEV, small extracellular vesicles; GSEA, gene set enrichment analysis; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; RT-qPCR, reverse transcription-quantitative PCR; pSmad, phosphorylated Smad.

    Article Snippet: The primary antibodies included POSTN antibody (cat. no. ab14041; 1:500; Abcam), CD9 (cat. no. ab236630; 1:1,000; Abcam), CD81 (cat. no. ab79559; 1:1,000; Abcam), Calnexin (10427-2-AP; 1:1,000, Proteintech, Wuhan, China), CD80 (cat. no. ab134120; 1:1,000; Abcam), CD86 (cat. no. abs115477; 1:1,000; Absin Bioscience), CD163 (sc-33715; 1:1,000, Santa Cruz Biotechnology), CD206 (cat. no. ab64693; 1:1,000; Abcam), BMPR2 (cat. no. abs147034; 1:1,000; Absin Bioscience), Phospho-Smad 1 (Ser463/465)/Smad5(Ser463/465)/Smad9(Ser465/467) (cat. no. 13820; 1:1,000; Cell Signaling Technology, Inc.), Smad5 (12534; 1:1,000; Cell Signaling Technology, Inc.), Smad9 (cat. no. abs131190; 1:1,000; Absin Bioscience) and GAPDH (cat. no. 10494-1-AP; 1:5,000; Proteintech Group, Inc.), followed by incubation with a HRP-conjugated Goat anti-Rabbit IgG (H+L) as the secondary antibody (cat. no. SA00001-2; 1:3,000; Proteintech Group, Inc.) for 2 h. After washing the membrane three times with 1X TBST, the protein bands were visualized using an ECL detection system.

    Techniques: Derivative Assay, Transfection, Expressing, Quantitative RT-PCR, Flow Cytometry, Western Blot, Negative Control, Reverse Transcription, Real-time Polymerase Chain Reaction

    BMPR2 (bone morphogenetic protein receptor type 2) is associated with pulmonary hypertension and breast cancer. A , Bioinformatic analysis reveals that BMPR2 is associated with 14 pulmonary arterial hypertension–related disease terms, 5 breast cancer–related disease terms, hyperandrogenism, and 2-oxo-hept-3-ene-1,7-dioate hydratase activity. B , Distribution of rare, predicted deleterious BMPR2 variants identified in breast tumors, including missense, nonsense, frameshift deletion, and insertion mutations from cBioPortal. The pulmonary arterial hypertension (PAH)–associated G83R variant is indicated. C , Copy number alteration (CNA) analysis of BMPR2 from cBioPortal breast cancer datasets (n=2599). Of 76 samples with copy number alterations, 92% were deep deletions and 8% amplifications. D , Violin plot depicting the distribution of BMPR2 log2 standardized mRNA levels across different breast cancer subtypes (basal-like, HER2-E, luminal A, and luminal B) and normal breast–like tissue. Embedded box plots represent the median (horizontal line) and interquartile range (box boundaries). Sample sizes for each group are indicated in parentheses. One-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons: ** P <0.01, **** P <0.0001. E , Quantification and representative immunofluorescence images showing decreased BMPRII protein expression in breast carcinoma compared with normal mammary gland tissue in human. Each dot represents a distinct patient, with values corresponding to the average signal from 8 mammary gland regions (n=4 non–breast cancer control, n=19 breast carcinoma). Unpaired t test. *** P <0.005. F through J , spontaneous mammary tumor development over time in Bmpr2-mutated ( Bmpr2 +/Δ71 ) and wild-type ( Bmpr2 +/+ ) rats. F , Kaplan-Meier curve showing the tumor-free cumulative risk in Bmpr2 +/Δ71 rats (red line) compared with Bmpr2 +/+ animals (black line) over time. Numbers at risk for each group are shown below the plot. G , Bar graph summarizing the percentage of rats with or without tumors at the end point. Bmpr2 +/Δ71 rats show a significantly higher tumor incidence (14%) compared with Bmpr2 +/+ controls (2%). Z score, n=71 Bmpr2 +/Δ71 and 45 Bmpr2 +/+ rats. H , Macroscopic and histological analysis of mammary tumors in Bmpr2 +/Δ71 rats. The representative macroscopic image ( left ) shows large tumor masses compared with healthy tissue. Histological sections depict healthy mammary tissue, fibroadenoma, and adenocarcinoma, stained with hematoxylin-eosin (H&E). Scale bars: 200 μm ( top ) and 50 μm ( bottom ). I , Correlation analysis between BMPR2 and BRCA1 expression in rat mammary tissue, showing a strong positive association (Pearson r=0.857, P <0.0001). J , Representative immunofluorescence staining of BMPR2 (green) and BRCA1 (magenta) in mammary glands from wild-type (WT) and Bmpr2 +/Δ71 rats. Scale bars: 50 μm. aa indicates amino acids; and A.U., arbitrary units.

    Journal: Circulation

    Article Title: Breast Cancer Reveals Latent BMPR2 -Related Susceptibility to Pulmonary Hypertension

    doi: 10.1161/CIRCULATIONAHA.125.079067

    Figure Lengend Snippet: BMPR2 (bone morphogenetic protein receptor type 2) is associated with pulmonary hypertension and breast cancer. A , Bioinformatic analysis reveals that BMPR2 is associated with 14 pulmonary arterial hypertension–related disease terms, 5 breast cancer–related disease terms, hyperandrogenism, and 2-oxo-hept-3-ene-1,7-dioate hydratase activity. B , Distribution of rare, predicted deleterious BMPR2 variants identified in breast tumors, including missense, nonsense, frameshift deletion, and insertion mutations from cBioPortal. The pulmonary arterial hypertension (PAH)–associated G83R variant is indicated. C , Copy number alteration (CNA) analysis of BMPR2 from cBioPortal breast cancer datasets (n=2599). Of 76 samples with copy number alterations, 92% were deep deletions and 8% amplifications. D , Violin plot depicting the distribution of BMPR2 log2 standardized mRNA levels across different breast cancer subtypes (basal-like, HER2-E, luminal A, and luminal B) and normal breast–like tissue. Embedded box plots represent the median (horizontal line) and interquartile range (box boundaries). Sample sizes for each group are indicated in parentheses. One-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons: ** P <0.01, **** P <0.0001. E , Quantification and representative immunofluorescence images showing decreased BMPRII protein expression in breast carcinoma compared with normal mammary gland tissue in human. Each dot represents a distinct patient, with values corresponding to the average signal from 8 mammary gland regions (n=4 non–breast cancer control, n=19 breast carcinoma). Unpaired t test. *** P <0.005. F through J , spontaneous mammary tumor development over time in Bmpr2-mutated ( Bmpr2 +/Δ71 ) and wild-type ( Bmpr2 +/+ ) rats. F , Kaplan-Meier curve showing the tumor-free cumulative risk in Bmpr2 +/Δ71 rats (red line) compared with Bmpr2 +/+ animals (black line) over time. Numbers at risk for each group are shown below the plot. G , Bar graph summarizing the percentage of rats with or without tumors at the end point. Bmpr2 +/Δ71 rats show a significantly higher tumor incidence (14%) compared with Bmpr2 +/+ controls (2%). Z score, n=71 Bmpr2 +/Δ71 and 45 Bmpr2 +/+ rats. H , Macroscopic and histological analysis of mammary tumors in Bmpr2 +/Δ71 rats. The representative macroscopic image ( left ) shows large tumor masses compared with healthy tissue. Histological sections depict healthy mammary tissue, fibroadenoma, and adenocarcinoma, stained with hematoxylin-eosin (H&E). Scale bars: 200 μm ( top ) and 50 μm ( bottom ). I , Correlation analysis between BMPR2 and BRCA1 expression in rat mammary tissue, showing a strong positive association (Pearson r=0.857, P <0.0001). J , Representative immunofluorescence staining of BMPR2 (green) and BRCA1 (magenta) in mammary glands from wild-type (WT) and Bmpr2 +/Δ71 rats. Scale bars: 50 μm. aa indicates amino acids; and A.U., arbitrary units.

    Article Snippet: Seven-week-old (180 g) WT and Bmpr2 +/Δ71 female Sprague-Dawley rats were randomized into 4 groups.

    Techniques: Activity Assay, Variant Assay, Immunofluorescence, Expressing, Control, Staining

    Mammary tumors promote pulmonary hypertension development in Bmpr2 (bone morphogenetic protein receptor type 2)–mutated female rats. Mammary tumors were induced in female wild-type (WT) and Bmpr2 +/Δ71 rats by 7,12-dimethylbenz[a]anthracene (DMBA). Compared with wild-type, wild-type+tumor, and Bmpr2 +/Δ71 without tumors, Bmpr2 +/Δ71 +tumor rats exhibited increased ( A ) right ventricular systolic pressure (RVSP), ( B ) elevated total pulmonary resistance (TPR), ( C ) reduced stroke volume (SV), and ( D ) decreased cardiac output (CO). E , Elastic Van Gieson staining revealed greater pulmonary vascular remodeling in Bmpr2 +/Δ71 +tumor rats, which was associated with ( F ) increased pulmonary arterial smooth muscle cell proliferation, as shown by proliferating cell nuclear antigen (PCNA) (red) and smooth muscle actin (green) immunofluorescence, with representative images in G (scale bars: 10 μm for elastic Van Gieson stain and proliferating cell nuclear antigen, 50 μm for CD45 and CD68). Monocyte accumulation (CD68) ( H ) and leukocyte infiltration (CD45) ( I ) were also elevated in Bmpr2 +/Δ71 +tumor lungs, accompanied by increased IL-1β mRNA expression (droplet digital polymerase chain reaction, housekeeping gene HPRT1) ( J ) and NF-κB protein levels (Western blot) ( K ). Statistical comparisons were performed using 1-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons. α-SMA indicates alpha–smooth muscle actin; AB, amido black; and DAPI, 4′,6-diamidino-2-phenylindole.

    Journal: Circulation

    Article Title: Breast Cancer Reveals Latent BMPR2 -Related Susceptibility to Pulmonary Hypertension

    doi: 10.1161/CIRCULATIONAHA.125.079067

    Figure Lengend Snippet: Mammary tumors promote pulmonary hypertension development in Bmpr2 (bone morphogenetic protein receptor type 2)–mutated female rats. Mammary tumors were induced in female wild-type (WT) and Bmpr2 +/Δ71 rats by 7,12-dimethylbenz[a]anthracene (DMBA). Compared with wild-type, wild-type+tumor, and Bmpr2 +/Δ71 without tumors, Bmpr2 +/Δ71 +tumor rats exhibited increased ( A ) right ventricular systolic pressure (RVSP), ( B ) elevated total pulmonary resistance (TPR), ( C ) reduced stroke volume (SV), and ( D ) decreased cardiac output (CO). E , Elastic Van Gieson staining revealed greater pulmonary vascular remodeling in Bmpr2 +/Δ71 +tumor rats, which was associated with ( F ) increased pulmonary arterial smooth muscle cell proliferation, as shown by proliferating cell nuclear antigen (PCNA) (red) and smooth muscle actin (green) immunofluorescence, with representative images in G (scale bars: 10 μm for elastic Van Gieson stain and proliferating cell nuclear antigen, 50 μm for CD45 and CD68). Monocyte accumulation (CD68) ( H ) and leukocyte infiltration (CD45) ( I ) were also elevated in Bmpr2 +/Δ71 +tumor lungs, accompanied by increased IL-1β mRNA expression (droplet digital polymerase chain reaction, housekeeping gene HPRT1) ( J ) and NF-κB protein levels (Western blot) ( K ). Statistical comparisons were performed using 1-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons. α-SMA indicates alpha–smooth muscle actin; AB, amido black; and DAPI, 4′,6-diamidino-2-phenylindole.

    Article Snippet: Seven-week-old (180 g) WT and Bmpr2 +/Δ71 female Sprague-Dawley rats were randomized into 4 groups.

    Techniques: Staining, Immunofluorescence, Expressing, Digital PCR, Western Blot

    Bmpr2 (bone morphogenetic protein receptor type 2) mutation is associated with proinflammatory mammary tumors and increased circulating inflammatory mediators. A , Volcano plot showing differentially expressed genes in mammary tumors induced by 7,12-dimethylbenz[a]anthracene (DMBA) in Bmpr2 +/Δ71 and wild-type (WT) female rats. Upregulated differentially expressed genes in Bmpr2 +/Δ71 tumors are shown in red, and downregulated differentially expressed genes are shown in blue. The dashed red line indicates the cutoff of adjusted P ( P adj)<0.05 and log 2 fold change (FC)>1. B , Gene Ontology (GO) analysis of upregulated differentially expressed genes was conducted using four databases: GO biological process (GO_BP, green), GO cellular component (GO_CC, blue), GO molecular function (GO_MF, mauve), and Kyoto Encyclopedia of Genes and Genomes (KEGG) (turquoise). The red arrowheads highlight GO terms related to inflammation. C , Bmpr2 +/Δ71 tumors exhibit increased monocyte accumulation (CD68 immunofluorescence) and ( D ) elevated leukocyte infiltration (CD45 immunofluorescence) compared with wild-type tumors. Representative images show positive cells, indicated by white arrows; scale bars: 50 µm. Bottom left insets display positive cells at higher magnification. E , the expression levels of 19 proinflammatory cytokines were measured in the blood of 15 Bmpr2 +/Δ71 +tumor animals and 15 wild-type+tumor animals. Bmpr2 +/Δ71 +tumor animals exhibit significantly increased levels of 5 proinflammatory cytokines: IL-6, LIX, IFN-γ, IL-1β, and IL-1α. F , Bmpr2 +/Δ71 +tumor animals show an overall increase in proinflammatory markers, quantified by a larger area under the curve (AUC). Statistical analysis was performed using unpaired t test. * P <0.05, ** P <0.01, *** P <0.005.

    Journal: Circulation

    Article Title: Breast Cancer Reveals Latent BMPR2 -Related Susceptibility to Pulmonary Hypertension

    doi: 10.1161/CIRCULATIONAHA.125.079067

    Figure Lengend Snippet: Bmpr2 (bone morphogenetic protein receptor type 2) mutation is associated with proinflammatory mammary tumors and increased circulating inflammatory mediators. A , Volcano plot showing differentially expressed genes in mammary tumors induced by 7,12-dimethylbenz[a]anthracene (DMBA) in Bmpr2 +/Δ71 and wild-type (WT) female rats. Upregulated differentially expressed genes in Bmpr2 +/Δ71 tumors are shown in red, and downregulated differentially expressed genes are shown in blue. The dashed red line indicates the cutoff of adjusted P ( P adj)<0.05 and log 2 fold change (FC)>1. B , Gene Ontology (GO) analysis of upregulated differentially expressed genes was conducted using four databases: GO biological process (GO_BP, green), GO cellular component (GO_CC, blue), GO molecular function (GO_MF, mauve), and Kyoto Encyclopedia of Genes and Genomes (KEGG) (turquoise). The red arrowheads highlight GO terms related to inflammation. C , Bmpr2 +/Δ71 tumors exhibit increased monocyte accumulation (CD68 immunofluorescence) and ( D ) elevated leukocyte infiltration (CD45 immunofluorescence) compared with wild-type tumors. Representative images show positive cells, indicated by white arrows; scale bars: 50 µm. Bottom left insets display positive cells at higher magnification. E , the expression levels of 19 proinflammatory cytokines were measured in the blood of 15 Bmpr2 +/Δ71 +tumor animals and 15 wild-type+tumor animals. Bmpr2 +/Δ71 +tumor animals exhibit significantly increased levels of 5 proinflammatory cytokines: IL-6, LIX, IFN-γ, IL-1β, and IL-1α. F , Bmpr2 +/Δ71 +tumor animals show an overall increase in proinflammatory markers, quantified by a larger area under the curve (AUC). Statistical analysis was performed using unpaired t test. * P <0.05, ** P <0.01, *** P <0.005.

    Article Snippet: Seven-week-old (180 g) WT and Bmpr2 +/Δ71 female Sprague-Dawley rats were randomized into 4 groups.

    Techniques: Mutagenesis, Immunofluorescence, Expressing

    Tumor-secreted IL-1β promotes proliferation of pulmonary arterial smooth muscle cells (PASMCs) in Bmpr2 +/Δ71 rats. A , Conditioned media (CM) harvested from Bmpr2 -mutated tumor cells (C.M.- Bmpr2 +/Δ71 ) increases proliferation of Bmpr2 +/Δ71 rat PASMCs ( Bmpr2 +/Δ71 r-PASMCs), as shown by Ki67 immunofluorescence (red). Representative images; scale bars: 50 µm. Elevated IL-1β levels in Bmpr2 +/Δ71 tumor cells compared with wild-type (WT) tumor cells were detected by ( B ) quantitative reverse transcription–polymerase chain reaction (qRT-PCR) (housekeeping gene HPRT1) and ( C ) IL-1β immunofluorescence (red). Representative images; scale bars: 5 µm. D , Quantification of Bmpr2 +/Δ71 r-PASMC proliferation: untreated Bmpr2 +/Δ71 r-PASMCs, Bmpr2 +/Δ71 r-PASMCs exposed to CM Bmpr2 +/Δ71 pretreated with IgG control antibody ( Bmpr2 +/Δ71 +IgG), and r Bmpr2 +/Δ71 -PASMCs exposed to CM Bmpr2 +/Δ71 pretreated with anti-IL-1β neutralizing monoclonal antibodies ( Bmpr2 +/Δ71 + IL-1β-ab). Ki67 immunofluorescence (red) was used for proliferation assessment. Representative images; scale bars: 50 µm. Statistical comparisons were performed using 1-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons and unpaired t test. A.U. indicates arbitrary units; DAPI, 4′,6-diamidino-2-phenylindole; IgG, immunoglobulin G; IL-1β, interleukin-1 beta; and r-PASMC, rat pulmonary arterial smooth muscle cell.

    Journal: Circulation

    Article Title: Breast Cancer Reveals Latent BMPR2 -Related Susceptibility to Pulmonary Hypertension

    doi: 10.1161/CIRCULATIONAHA.125.079067

    Figure Lengend Snippet: Tumor-secreted IL-1β promotes proliferation of pulmonary arterial smooth muscle cells (PASMCs) in Bmpr2 +/Δ71 rats. A , Conditioned media (CM) harvested from Bmpr2 -mutated tumor cells (C.M.- Bmpr2 +/Δ71 ) increases proliferation of Bmpr2 +/Δ71 rat PASMCs ( Bmpr2 +/Δ71 r-PASMCs), as shown by Ki67 immunofluorescence (red). Representative images; scale bars: 50 µm. Elevated IL-1β levels in Bmpr2 +/Δ71 tumor cells compared with wild-type (WT) tumor cells were detected by ( B ) quantitative reverse transcription–polymerase chain reaction (qRT-PCR) (housekeeping gene HPRT1) and ( C ) IL-1β immunofluorescence (red). Representative images; scale bars: 5 µm. D , Quantification of Bmpr2 +/Δ71 r-PASMC proliferation: untreated Bmpr2 +/Δ71 r-PASMCs, Bmpr2 +/Δ71 r-PASMCs exposed to CM Bmpr2 +/Δ71 pretreated with IgG control antibody ( Bmpr2 +/Δ71 +IgG), and r Bmpr2 +/Δ71 -PASMCs exposed to CM Bmpr2 +/Δ71 pretreated with anti-IL-1β neutralizing monoclonal antibodies ( Bmpr2 +/Δ71 + IL-1β-ab). Ki67 immunofluorescence (red) was used for proliferation assessment. Representative images; scale bars: 50 µm. Statistical comparisons were performed using 1-way ANOVA followed by Tukey-Kramer post hoc tests for multiple comparisons and unpaired t test. A.U. indicates arbitrary units; DAPI, 4′,6-diamidino-2-phenylindole; IgG, immunoglobulin G; IL-1β, interleukin-1 beta; and r-PASMC, rat pulmonary arterial smooth muscle cell.

    Article Snippet: Seven-week-old (180 g) WT and Bmpr2 +/Δ71 female Sprague-Dawley rats were randomized into 4 groups.

    Techniques: Immunofluorescence, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Control, Bioprocessing

    Schematic summary of the bidirectional relationship between BMPR2 (bone morphogenetic protein receptor type 2) deficiency, breast cancer, and pulmonary arterial hypertension (PAH). Preclinical setting: Bmpr2 +/Δ71 rats, characterized by reduced BMPR2 and BRCA1 expression, develop spontaneous mammary tumors with aging. Upon 7,12-dimethylbenz[a]anthracene (DMBA) exposure, Bmpr2 +/Δ71 rats exhibit exacerbated pulmonary hypertension, associated with increased lung inflammatory cell infiltration, elevated IL-1β levels, pulmonary vascular remodeling, and enhanced pulmonary arterial smooth muscle cell (PASMC) proliferation. Mammary tumors from Bmpr2 +/Δ71 rats show increased IL-1β expression and inflammatory infiltration, leading to higher circulating IL-1β and a proproliferative paracrine effect on pulmonary arterial smooth muscle cells. Human patients: Population-level analysis of the French National Healthcare Database revealed a bidirectional epidemiologic association between breast cancer and pulmonary arterial hypertension. The incidence of breast cancer was increased in patients with pulmonary arterial hypertension (215 vs 97 per 100 000 person-years), while the incidence of pulmonary arterial hypertension was higher in patients with breast cancer (66 vs 7 per 1 000 000 person-years). Transcriptomic and proteomic analyses of human samples showed reduced BMPR2 mRNA and protein levels in breast carcinoma compared with normal breast tissue. IL-1β indicates interleukin-1 beta.

    Journal: Circulation

    Article Title: Breast Cancer Reveals Latent BMPR2 -Related Susceptibility to Pulmonary Hypertension

    doi: 10.1161/CIRCULATIONAHA.125.079067

    Figure Lengend Snippet: Schematic summary of the bidirectional relationship between BMPR2 (bone morphogenetic protein receptor type 2) deficiency, breast cancer, and pulmonary arterial hypertension (PAH). Preclinical setting: Bmpr2 +/Δ71 rats, characterized by reduced BMPR2 and BRCA1 expression, develop spontaneous mammary tumors with aging. Upon 7,12-dimethylbenz[a]anthracene (DMBA) exposure, Bmpr2 +/Δ71 rats exhibit exacerbated pulmonary hypertension, associated with increased lung inflammatory cell infiltration, elevated IL-1β levels, pulmonary vascular remodeling, and enhanced pulmonary arterial smooth muscle cell (PASMC) proliferation. Mammary tumors from Bmpr2 +/Δ71 rats show increased IL-1β expression and inflammatory infiltration, leading to higher circulating IL-1β and a proproliferative paracrine effect on pulmonary arterial smooth muscle cells. Human patients: Population-level analysis of the French National Healthcare Database revealed a bidirectional epidemiologic association between breast cancer and pulmonary arterial hypertension. The incidence of breast cancer was increased in patients with pulmonary arterial hypertension (215 vs 97 per 100 000 person-years), while the incidence of pulmonary arterial hypertension was higher in patients with breast cancer (66 vs 7 per 1 000 000 person-years). Transcriptomic and proteomic analyses of human samples showed reduced BMPR2 mRNA and protein levels in breast carcinoma compared with normal breast tissue. IL-1β indicates interleukin-1 beta.

    Article Snippet: Seven-week-old (180 g) WT and Bmpr2 +/Δ71 female Sprague-Dawley rats were randomized into 4 groups.

    Techniques: Expressing